barcodex 1.0.9

Description:

barcodex 1.0.9

# BarcodEX #
BarcodEX is tool for extracting Unique Molecular Identifiers (UMIs) from single or paired-end read sequences.
It can handle UMIs inline with reads or located in separate fastqs.
Installation from PyPi
BarcodEx is available from PyPi
pip install barcodex
or
python -m pip install barcodex
Extraction of UMI sequences
BarcodEx extracts UMIs in read sequences or in fastqs with extract inline or extract separate sub-commands
Extracts UMIs in read sequences
usage: barcodex --prefix PREFIX --separator SEPARATOR extract --umilist UMILIST inline --r1_in FASTQ1 --r2_in FATSQ2 --pattern1 PATTERN1 --pattern2 PATTERN2 --full_match
Parameters



argument
purpose
required/optional




--r1_in
Path(s) to FASTQ(s) containing read 1
required


--r2_in
Path(s) to FASTQ(s) containing read 2
optional


--pattern1
pattern or regex for extracting UMIs in read 1
optional


--pattern2
pattern or regex for extracting UMIs in read 2
optional


--prefix
Specifies the start of the output files
required


--separator
String separating the UMI sequence in the read name
required


--umilist
Path to file with valid UMIs
optional


--full_match
Requires the regex pattern to match the entire read sequence
optional



--pattern1 and --pattern2 extract UMIs respectively in FASTQ 1 and FASTQ2. At least 1 pattern must be provided.
Extracts UMIs in fastqs
usage: barcodex --prefix PREFIX --separator SEPARATOR --umilist UMILIST extract separate --r1_in FASTQ1 --r2_in FATSQ2 --ru_in UMIs
Parameters



argument
purpose
required/optional




--r1_in
Path(s) to FASTQ(s) containing read 1
required


--r2_in
Path(s) to FASTQ(s) containing read 2
optional


--ru_in
Path(s) to FASTQ(s) containing UMIs
required


--prefix
Specifies the start of the output files
required


--separator
String separating the UMI sequence in the read name
required


--umilist
Path to file with valid UMIs
optional



BarcodEx extracts UMIs using either a pattern sequence or a regular expression and appends the concatenated UMIs from each read separated by a "." to the read name preceded by a separator string specified in the command.
UMIs can be extracted from read 1 and/or read 2 using respectively --pattern1 and --pattern2. At leat 1 pattern must be used. When extracting UMIs in read 1 and read 2, --pattern1 and --pattern2 must be both either a string sequence or a regular expression.
Reads that are not matching the provided patterns are discarded. Discarded reads are written to file for inspection. Morover, the extracted sequences are also recovered and written to file.
--prefix specifies the start of the output files. (e.g --prefix x would result in x_R1.fastq.gz, x_discarded.R1.fastq.gz, x_extracted.R1.fastq.gz, x_UMI_counts.json, x_extraction_metrics.json)
Extraction with a string pattern
The pattern sequence must include one or more Ns, indicating the UMI bases, optionally followed by any nuccleotides corresponding to spacer sequence.
For instance the pattern NNNNN extracts the first 5 nucleotides from the read whereas pattern NNNNNATCG extracts the first 9 nucleotides, appends nucleotides 1-5 to the read name and discard spacer ATCG. Reads not matching NNNNNATCG are discarded.
Extraction with the pattern sequence always extracts UMIs at the beginning of the read sequence. Extraction with regular expression offers more flexibility in the UMI design (see below).
As an example, consider read:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593 1:N:0:
TCATGTCTGCTAATGGGAAAGAGTGTCCTAACTGTCCCAGATCGTTTTTTCTCACGTCTTTTCTCCTTTCACTTCTCTTTTTCTTTTTCTTTCTTCTTCTT
+
1>1A1DDF11DBDGFFA111111D1FEEG31AD1DAA1110BA00000//01A2A/B/B/212D2111D1222D12122B1B01D1@101112@D2D12BB

Extraction with pattern NNNNNNNNNNNNATGGGAAAGAGTGTCC will extract UMI TCATGTCTGCTA and add it to the read name. Spacer sequence ATGGGAAAGAGTGTCC is removed from read.
So the new read is now:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593_TCATGTCTGCTA 1:N:0:
TAACTGTCCCAGATCGTTTTTTCTCACGTCTTTTCTCCTTTCACTTCTCTTTTTCTTTTTCTTTCTTCTTCTT
+
G31AD1DAA1110BA00000//01A2A/B/B/212D2111D1222D12122B1B01D1@101112@D2D12BB

Extracted sequence TCATGTCTGCTAATGGGAAAGAGTGTCC and its corresponding qualities 1>1A1DDF11DBDGFFA111111D1FEE are written to file filename.extracted.fastq.gz.
Extraction with a regular expression
Regular expressions allow more flexibility for extracting UMIs, in particular UMIs with complex design and UMIs not starting at the beginning of the read.
A good introduction to regular expression can be found in this Regular Expression HOWTO.
BarcodEx depends on the regex module rather than the standard re module because the former allows fuzzy matching.
Sequences are extracted from the read using named groups within the regex. Allowed named groups are umi and discard. Syntax with named groups is as follow:
(?<umi>.{3})(?<discard>T{2}): extracts a 3bp UMI followed by TT spacer that is removed from read and discarded
The discard group removes nucleotides and qualities from the read while the umi group extracts the UMI that gets added to the read name.
Any sequence not contained in umi and discard groups will remain in the read. Thus, it is important to construct the regular expression such that the begining of the read is captured in groups.
For instance, consider the following read:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593 1:N:0:
AATCGTCCATCG
+
1>1A1DDF11DB

The regex (?<umi>.{3})(?<discard>C{2}) will extract UMI CGT and discard spacer CC. But the first 3 nucleotides AAT will remain in the read with new read being:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593_CGT 1:N:0:
AATATCG
+
1>111DB

To prevent the AAT before the UMI CGT to be part of the read, we need to account for the nucleotides upstream in the UMI in the regex (?<discard1>^.*)(?<umi>.{3})(?<discard2>C{2})
This is particularly when restoring the original fastqs (see below).
The processed read with annotated UMI becomes:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593_CGT 1:N:0:
ATCG
+
11DB

And read with extracted sequences and qualities is written to a separate fastq filename.extracted.fastq.gz:
@MISEQ753:39:000000000-BDH2V:1:1101:17521:1593_CGT 1:N:0:
AATCGTCC
+
1>1A1DDF

Multiple umi and discard named groups are allowed within the regex but they should be named differently. Naming is not important as long as groups contain the strings umi and discardwithout special characters.
For instance the following 2 regex will give the same output:

(?<discard_1>^.*)(?<umi>.{3})(?<discard_a>C{2})') and (?<discard1>^.*)(?<umi>.{3})(?<discard2>C{2})')
(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)|(?P<umi_2>^[ACGT]{3})(?P<discard_2>T) and (?P<umi_a>^[ACGT]{3}[ACG])(?P<discard_a>T)|(?P<umi_b>^[ACGT]{3})(?P<discard_b>T)

Filtering extracted UMIs against a list
The UMIs will only be accepted if they match an allow list provided with --umilist.
The list differs when UMIs are extracted from the read sequences or when they are located in a separate fastq.
When UMIs are located within the read sequences, the list is a text file with one UMI per line. In the case of 2 reads with embedded UMIs, the two parts of the UMI must be on separate lines, optionally followed by the read number they apply to.
So, AAA would be allowed for either read 1 or read 2, while CCC 2 will allow CCC only on read 2.
It's also possible to write AAA 1 2 or AAA 1 and AAA 2 if desired.
When UMIs are located in separate fastq, it is assumed that both reads in paired end sequencing should be annotated with the same UMI.
Here, the list of accepted UMI is simply a 1-column table with valid UMIs that are expected in the separate fastq.
Extraction of UMIs in single or paired read sequences
Parameters --r1_in and --r2_in indicate the paths to the read 1 and read 2 fastqs. --r1_in is always required and omitting --r2_in indicates single end sequences.
BarcodEx requires gzipped input fastqs and outputs gzipped fastqs. Input fastqs for paired end data must be in sync.
--prefix specifies the start of the output files (e.g. foo/bar/x_R1.fastq.gz, foo/bar/x_R2.fastq.gz)
Extraction from multiple input fastqs
Multiple input fastqs can be processed together for read 1 and/or read 2. However, barcodex generates a single output fastq for single end data and 2 output fastqs for paired read data.
The files mut be passed to --r1_in for read 1 fastqs and --r2_in for read 2 fastqs, each file being separated by white space.
The number of input fastqs for paired data must be the same for read 1 and read 2 and each list of files must be in the same order.
Extraction of UMIs not inline with reads
Sub-command extract inline extracts UMIs located within the read sequences while sub-command extract separate is used to extract UMIs located in fastq.
Recovery of discarded reads and extracted sequences
Reads without a matching pattern are written to file for inspection. --prefix specifies the start of the output files:
foo/bar/x_discarded.R1.fastq.gz and/or foo/bar/x_discarded.R2.fastq.gz.
Extracted read sequences (UMIs and any spacer sequence removed from read, along with their qualities) are also written to file:
foo/bar/x_extracted.R1.fastq.gz and/or foo/bar/x_extracted.R2.fastq.gz.
Similarly, UMIs located in fastq and filtered out with --umilist are discarded along with the corresponding reads 1 and/or 2 resulting in files:
filename_discarded_umis.fastq.gz, filename_discarded.R1.fastq.gz and/or filename_discarded.R2.fastq.gz.
Valid UMIs are also written to output fastq filename_extracted_umis.fastq.gz.
UMIs and reads metrics
Two files with metrics of the UMI extraction are written in json format in the same directory specified by --prefix.
--prefix foo/bar/x results in foo/bar/x_extraction_metrics.json and foo/bar/x_UMI_counts.json.
The first json captures information about the extraction process:

total reads/pairs processed
number of reads/pairs with matching pattern
number of reads/pairs with non-matching pattern
number of reads/pairs discarded due to unknown UMI
pattern1
pattern2
umi-list

The second json records the UMI counts after extraction. For paired end data it counts the concatenated sequences with UMIs from read 1 and read 2, adding a "." separator to track the read origin of each UMI.
For instance, "AAA.TCG": 10 in the json file indicates that sequence AAATCG is found 10 times in all the extracted UMIs, and that it is made of AAA from read 1 and TCG from read 2.
Restoring original fastqs
BarcodEx restores the original fastqs with the restore inline or restore separate sub-commands.
However, only 1 or 2 output fastqs are generated even if UMI extraction accepts multiple input fastqs. This is equivalent of merging the input fastqs.
Care should be taken to construct a regex that captures the UMI from the start (or up to the end) of the read if one wishes to restore the original fastqs and read sequences.
Morever, fastqs with extracted read sequences and/or discarded reads (if any) should be also serve as input fastqs along with the processed fastqs containing annotated reads.
Restore fastqs from extraction of UMIs in read sequences
usage: barcodex --prefix PREFIX --separator SEPARATOR restore inline --umi_pos UMI_POS --r1_processed R1_PROCESSED --r2_processed R2_PROCESSED --r1_extracted R1_EXTRACTED --r2_extracted R2_EXTRACTED --r1_discarded R1_DISCARDED --r2_discarded R2_DISCARDED
Parameters



argument
purpose
required/optional




--r1_processed
FASTQ containing read 1 annotated with UMI
required


--r2_processed
FASTQ containing read 2 annotated with UMI
optional


--r1_extracted
FASTQ containing extracted sequence from read 1
optional


--r2_extracted
FASTQ containing extracted sequence from read 2
optional


--r1_discarded
FASTQ containing discarded reads 1
optional


--r2_discarded
FASTQ containing discarded reads 2
optional


--prefix
Specifies the start of the output files
required


--separator
String separating the UMI sequence in the read name
required


--umi_pos
Indicates if UMI was extracted from 5' or 3' read end
required



Restore fastqs from processing of UMIs located in separate file
usage: barcodex --prefix PREFIX --separator SEPARATOR restore separate --r1_processed R1_PROCESSED --r2_processed R2_PROCESSED --r1_discarded R1_DISCARDED --r2_discarded R2_DISCARDED --umi_extracted UMI_EXTRACTED --umi_discarded UMI_DISCARDED
Parameters



argument
purpose
required/optional




--r1_processed
FASTQ 1 with UMI-annotated reads
required


--r2_processed
FASTQ 2 with UMI-annotated reads for paired-end sequences
optional


--r1_discarded
FASTQ with rejected read 1 sequences
optional


--r2_discarded
FASTQ with rejected read 2 sequences
optional


--umi_extracted
FASTQ with valid UMIs annotating reads in FASTQ 1 and/or FASTQ 2
required


--umi_discarded
FASTQ with invalid UMIs that are not in processed FASTQs
optional



Importing Barcodex as a module
BarcodEx can be run as a script or imported as a module to perform extraction within your own script.
from barcodex import extract_barcodes_inline

help(barcodex.extract_barcodes_inline)
Help on function extract_barcodes_inline in module barcodex:

extract_barcodes_inline(r1_in, pattern1, prefix, pattern2=None, r2_in=None, full_match=False, separator='_', umilist=None)
(list, str | None, str, str | None, str | None, bool, str, str | None) -> None

Parameters
----------
- r1_in (list): Path(s) to the input FASTQ 1
- pattern1 (str or None): String sequence or regular expression used for matching and extracting UMis from reads in FASTQ 1.
The string sequence must look like NNNATCG or NNN. UMI nucleotides are labeled with "N".
Spacer nucleotides following Ns are used for matching UMIs but are discarded from reads
None if UMIs are extracted only from FASTQ 2 for paired end sequences
- prefix (str): Specifies the start of the output files and stats json files
- pattern2 (str or None): String sequence or regular expression used for matching and extracting UMis from reads in FASTQ 2.
The string sequence must look like NNNATCG or NNN. UMI nucleotides are labeled with "N".
Spacer nucleotides following Ns are used for matching UMIs but are discarded from reads
None if UMIs are extracted only from FASTQ 1 for paired end sequences
- r2_in (list or None): Path(s) to the input FASTQ 2
- full_match (bool): True if the regular expression needs to match the entire read sequence
- separator (str): String separating the UMI sequence and part of the read header
- umilist (str or None): Path to file with accepted barcodes

Example commands
Example 1. Paired end end with string sequence
Extraction of UMIs in read 1 for paired end data with inline UMIs with a string sequence.
Extracts the first 12 bp UMI when followed by spacer ATGGGAAAGAGTGTCC and remove spacer from read.
Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix output extract inline --r1_in myfile_R1.fastq --r2_in myfile_R2.fastq --pattern NNNNNNNNNNNNATGGGAAAGAGTGTCC \

Example 2. Paired end with regex
Extraction of UMIs in read 1 and read 2 for paired end data with inline UMIs with a regular expression.
Extracts the first 3 nucleotides as UMI and discards the next 2 nucleotide spacer sequence from each read.
Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix output extract inline --r1_in myfile_R1.fastq.gz --r2_in myfile_R2.fastq.gz --pattern1 "(?<umi>.{3})(?<discard>.{2})" --pattern2 "(?<umi>.{3})(?<discard>.{2})"

Example 3. Full match regex option
Same as Example 2, but the regex patterns are modified to suit the --full_match regex requirement.
barcodex --separator "_" --prefix output extract inline --r1_in myfile_R1.fastq.gz --r2_in myfile_R2.fastq.gz --pattern1 "(?<umi>.{3})(?<discard>.{2}.+)" --pattern2 "(?<umi>.{3})(?<discard>.{2}.+)" --full_match

Example 4. List of UMIs
Extraction of UMIs in read 1 and read 2 for paired end data with inline UMIs with a regular expression.
Extracts a 4 bp UMI not ending with T and discard a following T spacer or a 3 bp UMI and discard the following T spacer.
UMIs start at the beginning of the read sequence and only higher caps A, T, C and G are allowed.
Extracted UMIs are checked against the true_barcode.txt UMI list. Reads with non-valid UMIs (ie. not present in true_barcode.txt) are discarded.
Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix output extract --umilist true_barcodes.txt inline --r1_in myfile_R1.fastq.gz --r2_in myfile_R2.fastq.gz --pattern1 "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)|(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)" --pattern2 "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)|(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"

example 5. Single end
Extraction of UMIs in read 1 for single end with inline UMIs with a regular expression.
Extracts the first 12 bp UMI when followed by spacer ATGGGAAAGAGTGTCC and remove spacer from read.
Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix x extract --umilist true_barcodes.txt inline --r1_in myfile_R1.fastq.gz --pattern1 "(?P<umi>^.{12})(?P<discard>ATGGGAAAGAGTGTCC)" \

Example 6. Multiple input fastqs
Extraction of UMIs in read 1 and read 2 for paired end data with inline UMIs with a regular expression from 4 input fastq1 and 4 input fastq2.
Extracts the first 3 nucleotides as UMI and discards the next 2 nucleotide spacer sequences from each read.
Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix output_umis extract --umilist true_barcodes.txt inline --r1_in myfile_R1.1.fastq.gz myfile_R1.2.fastq.gz myfile_R1.3.fastq.gz myfile_R1.4.fastq.gz --r2_in myfile_R2.1.fastq.gz myfile_R2.2.fastq.gz myfile_R2.3.fastq.gz myfile_R2.4.fastq.gz --pattern1 "(?<umi>.{3})(?<discard>.{2})" --pattern2 "(?<umi>.{3})(?<discard>.{2})"

Example 7. Paired end with UMIs in file
Extraction of UMIs in read 1 and read 2 for paired end data with UMIs located in read 3 with a regular expression.
Extracts the first 10 nucleotides as UMI. Umis are preceded by an underscore in the read header.
barcodex --separator "_" --prefix foo/bar/myfastq.umis extract separate --r1_in myfile_R1.fastq.gz --r2_in myfile_R2.fastq.gz --ru_in myfile_R3.fastq.gz

Example 8. Importing BarcodEx as module within a script to extract UMIs
Sample as Example 2.
import gzip
from itertools import zip_longest
import regex
import json
import time
from barcodex import extract_barcodes_inline


extract_barcodes_inline(['myfile_R1.fastq.gz'], pattern1='(?<umi>.{3})(?<discard>.{2})', prefix='x',
pattern2='(?<umi>.{3})(?<discard>.{2})', r2_in=['myfile_R2.fastq.gz'], full_match=False, separator='_', umilist=None)


Example 9. Importing BarcodEx as module within a script to restore fastqs
Generate input fastqs before extraction of inline UMIs.
import gzip
from itertools import zip_longest
import regex
import json
import time
from barcodex import reconstruct_fastqs_inline

reconstruct_fastqs_inline('x', '_', '5prime', 'filename_R1.fastq.gz', 'filename_extracted.R1.fastq.gz', 'filename_discarded.R1.fastq.gz', 'filename_R1.fastq.gz', 'filename_extracted.R2.fastq.gz', 'filename_discarded.R2.fastq.gz')

Example 10. Restore paired-end fastqs from inline-UMI extraction
Inline UMIs were extracted from read 1 and read 2 and added to read names with a "_" separator. The same separator variable should be use to restore the original fastqs.
UMIs were extracted from the 5' read end.
barcodex --separator "_" --prefix my_fastqs restore inline --umi_pos 5prime --r1_processed x_R1_fastq.gz --r2_processed x_R2_fastq.gz --r1_extracted x_extracted.R1.fastq.gz --r2_extracted x_extracted.R2.fastq.gz --r1_discarded x_discarded.R1.fastq.gz --r2_discarded x_discarded.R2.fastq.gz

Example 11. Restore single-end fastq with UMI located in separate file
UMIs located in separate file were added to read 1 "_" separator.
Some UMIs were filtered out with a umilist.
barcodex --separator "_" --prefix my_fastqs restore separate --r1_processed x_R1_fastq.gz --r1_discarded x_discarded.R1.fastq.gz --umi_extracted x__extracted_umis.fastq.gz --umi_discarded x_discarded_umis.fastq.gz