Description:

rnapykin 0.3.0

Python bindings for rnapkin! :snake: :crab:
Rnapkin is a fast, convenient CLI utility for drawing RNAs that produces stylish SVGs.
These Python bindings provide an easy way to use rnapkin's functionality directly from your Python scripts.
This is an early implementation that currently only exposes the rna2svg function.
It takes an RNA fold in rnapkin compliant format and returns the corresponding
SVG as a string.
Installation
pip install rnapykin

Quick Example
from rnapykin import rna2svg

gorgeous_rna = """
UUAUAGGCGAUGGAGUUCGCCAUAAACGCUGCUUAGCUAAUGACUCCUACCAGUAUCACUACUGGUAGGAGUCUAUUUUUUU
.....(((((......)))))......(((....)))....((((((((((((((....)))))))))))))).........
"""

# rna / theme / rotation in degrees / background opacity / horizontal flip / vertical flip
svg = rna2svg(gorgeous_rna, "dark", 0, 1., False, False)

# do with it what you want. Save it, embed it in HTML, whatevs c:
with open("gorgeous_rna.svg", "w") as f:
f.write(svg)

License

For personal and professional use. You cannot resell or redistribute these repositories in their original state.

Share

• Share on Facebook
• Share on Twitter